Exercise 4.4

From Earlham CS Department
Revision as of 18:01, 23 September 2009 by Erika (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Return to Week 1

Exercise 4.4 in Beginning Perl for Bioinformatics

#!/usr/bin/perl -w
use strict;

#Erika Phelps
#Sept. 21, 2009
#Exercise 4.4

#Do the same thing  as Exercise 4.3, but use the string directives \u and \L 
#for upper and lower case.

#The DNA (input both in upper and lower case)

my $DNA1 = 'ATGCCGGTAGAATATACCCGA';
my $DNA2 = 'cccggctaatatacgctag';

#Print the DNA to the screen

print "Here are the DNA sequences that have been provided:\n\n";

print "DNA1:$DNA1.\n\n";

print "DNA2: $DNA2.\n\n";

#Concatenating the DNA

my $DNA3 = "$DNA1$DNA2";

#Print the concatenated DNA all in lowercase 

print "The concatenated DNA is (lowercase):\L$DNA3.\n\n";

#Print the concatenated DNA all in uppercase

print "The concatenated DNA is (uppercase):\U$DNA3.\n";

#End of program

exit;