Exercise 4.4

Return to Week 1

Exercise 4.4 in Beginning Perl for Bioinformatics

#!/usr/bin/perl -w use strict;

#Erika Phelps #Sept. 21, 2009 #Exercise 4.4

1. Do the same thing as Exercise 4.3, but use the string directives \u and \L
2. for upper and lower case.

1. The DNA (input both in upper and lower case)

my $DNA1 = 'ATGCCGGTAGAATATACCCGA'; my $DNA2 = 'cccggctaatatacgctag';

1. Print the DNA to the screen

print "Here are the DNA sequences that have been provided:\n\n";

print "DNA1:$DNA1.\n\n";

print "DNA2: $DNA2.\n\n";

1. Concatenating the DNA

my $DNA3 = "$DNA1$DNA2";

1. Print the concatenated DNA all in lowercase

print "The concatenated DNA is (lowercase):\L$DNA3.\n\n";

1. Print the concatenated DNA all in uppercase

print "The concatenated DNA is (uppercase):\U$DNA3.\n";

1. End of program

exit;