Exercise 4.4
Return to Week 1
Exercise 4.4 in Beginning Perl for Bioinformatics
#!/usr/bin/perl -w use strict; #Erika Phelps #Sept. 21, 2009 #Exercise 4.4 #Do the same thing as Exercise 4.3, but use the string directives \u and \L #for upper and lower case. #The DNA (input both in upper and lower case) my $DNA1 = 'ATGCCGGTAGAATATACCCGA'; my $DNA2 = 'cccggctaatatacgctag'; #Print the DNA to the screen print "Here are the DNA sequences that have been provided:\n\n"; print "DNA1:$DNA1.\n\n"; print "DNA2: $DNA2.\n\n"; #Concatenating the DNA my $DNA3 = "$DNA1$DNA2"; #Print the concatenated DNA all in lowercase print "The concatenated DNA is (lowercase):\L$DNA3.\n\n"; #Print the concatenated DNA all in uppercase print "The concatenated DNA is (uppercase):\U$DNA3.\n"; #End of program exit;