Difference between revisions of "Exercise 4.4"
Jump to navigation
Jump to search
(New page: Return to Week 1 <b>Exercise 4.4 in <i>Beginning Perl for Bioinformatics</i></b> <br><br> <nowiki>#!/usr/bin/perl -w use strict;</nowiki> <nowiki>#Erika Phelps #Sept. 21, 2009 #Exerc...) |
|||
| Line 3: | Line 3: | ||
<b>Exercise 4.4 in <i>Beginning Perl for Bioinformatics</i></b> | <b>Exercise 4.4 in <i>Beginning Perl for Bioinformatics</i></b> | ||
<br><br> | <br><br> | ||
| − | < | + | <pre>#!/usr/bin/perl -w |
| − | use strict; | + | use strict; |
| − | + | #Erika Phelps | |
#Sept. 21, 2009 | #Sept. 21, 2009 | ||
| − | #Exercise 4.4 | + | #Exercise 4.4 |
#Do the same thing as Exercise 4.3, but use the string directives \u and \L | #Do the same thing as Exercise 4.3, but use the string directives \u and \L | ||
| Line 41: | Line 41: | ||
exit; | exit; | ||
| + | </pre> | ||
Latest revision as of 13:01, 23 September 2009
Return to Week 1
Exercise 4.4 in Beginning Perl for Bioinformatics
#!/usr/bin/perl -w use strict; #Erika Phelps #Sept. 21, 2009 #Exercise 4.4 #Do the same thing as Exercise 4.3, but use the string directives \u and \L #for upper and lower case. #The DNA (input both in upper and lower case) my $DNA1 = 'ATGCCGGTAGAATATACCCGA'; my $DNA2 = 'cccggctaatatacgctag'; #Print the DNA to the screen print "Here are the DNA sequences that have been provided:\n\n"; print "DNA1:$DNA1.\n\n"; print "DNA2: $DNA2.\n\n"; #Concatenating the DNA my $DNA3 = "$DNA1$DNA2"; #Print the concatenated DNA all in lowercase print "The concatenated DNA is (lowercase):\L$DNA3.\n\n"; #Print the concatenated DNA all in uppercase print "The concatenated DNA is (uppercase):\U$DNA3.\n"; #End of program exit;
