Exercise 4.3

Return to Week 1

Exercise 4.3 in Beginning Perl for Bioinformatics

#!/usr/bin/perl -w use strict;

#Erika Phelps #Sept 21, 2009 #Exercise 4.3

#Write a program that prints DNA (which could be in upper or lower case) #in lowercase; write another that prints the DNA in uppercase. Use the #function tr///.

1. The DNA (input both in upper and lower case)

my $DNA1 = 'ATGCCGGTAGAATATACCCGA'; my $DNA2 = 'cccggctaatatacgctag';

1. Print the DNA to the screen

print "Here are the DNA sequences that have been provided:\n\n";

print "DNA1:$DNA1.\n\n";

print "DNA2: $DNA2.\n\n";

1. Concatenating the DNA

my $DNA3 = "$DNA1$DNA2";

1. Make a copy of the DNA for both upper and lower case

my $DNAlc = $DNA3; my $DNAuc = $DNA3;

1. Print the concatenated DNA all in lowercase

$DNAlc =~ tr/ACGTacgt/acgt/;

print "The concatenated DNA is (lowercase):$DNAlc.\n\n";

1. Print the concatenated DNA all in uppercase

$DNAuc =~ tr/ACGTacgt/ACGT/;

print "The concatenated DNA is (uppercase):$DNAuc.\n";

1. End of program

exit;