Exercise 4.3
Return to Week 1
Exercise 4.3 in Beginning Perl for Bioinformatics
:<source lang=perl>
- !/usr/bin/perl -w
use strict;
- Erika Phelps
- Sept 21, 2009
- Exercise 4.3
- Write a program that prints DNA (which could be in upper or lower case)
- in lowercase; write another that prints the DNA in uppercase. Use the
- function tr///.
- The DNA (input both in upper and lower case)
my $DNA1 = 'ATGCCGGTAGAATATACCCGA';
my $DNA2 = 'cccggctaatatacgctag';
- Print the DNA to the screen
print "Here are the DNA sequences that have been provided:\n\n";
print "DNA1:$DNA1.\n\n";
print "DNA2: $DNA2.\n\n";
- Concatenating the DNA
my $DNA3 = "$DNA1$DNA2";
- Make a copy of the DNA for both upper and lower case
my $DNAlc = $DNA3;
my $DNAuc = $DNA3;
- Print the concatenated DNA all in lowercase
$DNAlc =~ tr/ACGTacgt/acgt/;
print "The concatenated DNA is (lowercase):$DNAlc.\n\n";
- Print the concatenated DNA all in uppercase
$DNAuc =~ tr/ACGTacgt/ACGT/;
print "The concatenated DNA is (uppercase):$DNAuc.\n";
- End of program
exit;
:<source lang=perl>