Difference between revisions of "Exercise 4.3"
Jump to navigation
Jump to search
| Line 3: | Line 3: | ||
<b>Exercise 4.3 in <i>Beginning Perl for Bioinformatics</i></b> | <b>Exercise 4.3 in <i>Beginning Perl for Bioinformatics</i></b> | ||
<br><br> | <br><br> | ||
| − | < | + | <code> |
#!/usr/bin/perl -w | #!/usr/bin/perl -w | ||
| − | use strict; | + | use strict; |
| − | + | #Erika Phelps | |
#Sept 21, 2009 | #Sept 21, 2009 | ||
| − | #Exercise 4.3 | + | #Exercise 4.3 |
| − | + | #Write a program that prints DNA (which could be in upper or lower case) | |
#in lowercase; write another that prints the DNA in uppercase. Use the | #in lowercase; write another that prints the DNA in uppercase. Use the | ||
| − | #function tr///. | + | #function tr///. |
#The DNA (input both in upper and lower case) | #The DNA (input both in upper and lower case) | ||
| Line 52: | Line 52: | ||
exit; | exit; | ||
| + | </code> | ||
Revision as of 11:04, 22 September 2009
Return to Week 1
Exercise 4.3 in Beginning Perl for Bioinformatics
- !/usr/bin/perl -w
use strict;
- Erika Phelps
- Sept 21, 2009
- Exercise 4.3
- Write a program that prints DNA (which could be in upper or lower case)
- in lowercase; write another that prints the DNA in uppercase. Use the
- function tr///.
- The DNA (input both in upper and lower case)
my $DNA1 = 'ATGCCGGTAGAATATACCCGA';
my $DNA2 = 'cccggctaatatacgctag';
- Print the DNA to the screen
print "Here are the DNA sequences that have been provided:\n\n";
print "DNA1:$DNA1.\n\n";
print "DNA2: $DNA2.\n\n";
- Concatenating the DNA
my $DNA3 = "$DNA1$DNA2";
- Make a copy of the DNA for both upper and lower case
my $DNAlc = $DNA3;
my $DNAuc = $DNA3;
- Print the concatenated DNA all in lowercase
$DNAlc =~ tr/ACGTacgt/acgt/;
print "The concatenated DNA is (lowercase):$DNAlc.\n\n";
- Print the concatenated DNA all in uppercase
$DNAuc =~ tr/ACGTacgt/ACGT/;
print "The concatenated DNA is (uppercase):$DNAuc.\n";
- End of program
exit;
