Exercise 4.1: Difference between revisions

From Earlham CS Department
Jump to navigation Jump to search
Erika (talk | contribs)
No edit summary
Erika (talk | contribs)
No edit summary
Line 3: Line 3:
Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.
Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.


"#!/usr/bin/perl -w
<nowiki>#!/usr/bin/perl -w
use strict;
use strict;


Line 67: Line 67:
#of trying to fix everything at once!  
#of trying to fix everything at once!  
#Yes, the errors do seem to very accurately locate the source of the error and
#Yes, the errors do seem to very accurately locate the source of the error and
#which line! I like the suggestion feature for what may have gone wrong..."
#which line! I like the suggestion feature for what may have gone wrong...</nowiki>

Revision as of 03:34, 21 September 2009

Return to Week 1

Exercise 4.1 in Beginning Perl for Bioinformatics.

#!/usr/bin/perl -w use strict; #Erika Phelps #Sept 20, 2009 #Homework Chp 4 #(using example 4-2) #concatemating DNA (that means, joining strings of DNA together) #Store two DNA fragments into two variables called $DNA1 and $DNA2 # #REMOVE SEMICOLON #Error message: 5 lines that say "global symbol requires explicit #package name. Syntex error on line 9 (correct) near "my" my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC'; my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA'; #*MISSPELL PRINT* #Error message: String found where operator expected line 22 (correct) near #"prnt" + message... (do you need to predeclare "prnt?) #Syntax error ... also NA fragments #Print the DNA onto the screen print "Here are the orginal two DNA fragments: \n\n"; print $DNA1, "\n"; print $DNA2, "\n\n"; #*ADD A CURLY BRACE RANDOMLY* #Error message:none, just added a curly brace in front of variable #*TYPE RANDOM TEXT* ("hello world" in comments w/out preceding "#") #Error message:First part of program ran, then message "Can't locate object #method "hello" via package "world" (perhaps you forgot to load "world"? #Concatemate the DNA fragments into a third variable and print them #Using "string interpolation" my $DNA3 = "$DNA1$DNA2"; print "Here is the concatenation of the first two fragments (version 1):\n\n"; print "$DNA3\n\n"; #An alternative way using the "dot operator": #Concatenate the DNA fragments into a third variable and print them my $DNA4 = $DNA1 . $DNA2; print "Here is the concatentation of the first two fragments (version 2):\n\n"; print "$DNA4\n\n"; #Print the same thing without using the variable $DNA3 or $DNA4 print "Here is the concatentation of the first two fragments (version 3):\n\n"; print $DNA1, $DNA2, "\n"; exit; #Sometimes a simple error generates many lines of code. When checking for errors #should try things out one at a time until no error message remains instead #of trying to fix everything at once! #Yes, the errors do seem to very accurately locate the source of the error and #which line! I like the suggestion feature for what may have gone wrong...