Exercise 4.1: Difference between revisions
Jump to navigation
Jump to search
New page: Return to Week 1 Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>. #!/usr/bin/perl -w use strict; #Erika Phelps #Sept 20, 2009 #Homework Chp 4 #(using example 4-2) #concate... |
No edit summary |
||
| Line 3: | Line 3: | ||
Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>. | Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>. | ||
#!/usr/bin/perl -w | "#!/usr/bin/perl -w | ||
use strict; | use strict; | ||
| Line 67: | Line 67: | ||
#of trying to fix everything at once! | #of trying to fix everything at once! | ||
#Yes, the errors do seem to very accurately locate the source of the error and | #Yes, the errors do seem to very accurately locate the source of the error and | ||
#which line! I like the suggestion feature for what may have gone wrong... | #which line! I like the suggestion feature for what may have gone wrong..." | ||
Revision as of 03:33, 21 September 2009
Return to Week 1
Exercise 4.1 in Beginning Perl for Bioinformatics.
"#!/usr/bin/perl -w use strict;
- Erika Phelps
- Sept 20, 2009
- Homework Chp 4
- (using example 4-2)
- concatemating DNA (that means, joining strings of DNA together)
- Store two DNA fragments into two variables called $DNA1 and $DNA2
- REMOVE SEMICOLON
- Error message: 5 lines that say "global symbol requires explicit
- package name. Syntex error on line 9 (correct) near "my"
my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC'; my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';
- MISSPELL PRINT*
- Error message: String found where operator expected line 22 (correct) near
- "prnt" + message... (do you need to predeclare "prnt?)
- Syntax error ... also NA fragments
- Print the DNA onto the screen
print "Here are the orginal two DNA fragments: \n\n";
print $DNA1, "\n";
print $DNA2, "\n\n";
- ADD A CURLY BRACE RANDOMLY*
- Error message:none, just added a curly brace in front of variable
- TYPE RANDOM TEXT* ("hello world" in comments w/out preceding "#")
- Error message:First part of program ran, then message "Can't locate object
- method "hello" via package "world" (perhaps you forgot to load "world"?
- Concatemate the DNA fragments into a third variable and print them
- Using "string interpolation"
my $DNA3 = "$DNA1$DNA2";
print "Here is the concatenation of the first two fragments (version 1):\n\n";
print "$DNA3\n\n";
- An alternative way using the "dot operator":
- Concatenate the DNA fragments into a third variable and print them
my $DNA4 = $DNA1 . $DNA2;
print "Here is the concatentation of the first two fragments (version 2):\n\n";
print "$DNA4\n\n";
- Print the same thing without using the variable $DNA3 or $DNA4
print "Here is the concatentation of the first two fragments (version 3):\n\n";
print $DNA1, $DNA2, "\n";
exit;
- Sometimes a simple error generates many lines of code. When checking for errors
- should try things out one at a time until no error message remains instead
- of trying to fix everything at once!
- Yes, the errors do seem to very accurately locate the source of the error and
- which line! I like the suggestion feature for what may have gone wrong..."