Difference between revisions of "Exercise 4.1"
Jump to navigation
Jump to search
(New page: Return to Week 1 Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>. #!/usr/bin/perl -w use strict; #Erika Phelps #Sept 20, 2009 #Homework Chp 4 #(using example 4-2) #concate...) |
|||
(4 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
Return to [[Week 1]] | Return to [[Week 1]] | ||
− | Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>. | + | '''Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.''' |
− | #!/usr/bin/perl -w | + | <pre>#!/usr/bin/perl -w |
use strict; | use strict; | ||
Line 36: | Line 36: | ||
#*TYPE RANDOM TEXT* ("hello world" in comments w/out preceding "#") | #*TYPE RANDOM TEXT* ("hello world" in comments w/out preceding "#") | ||
#Error message:First part of program ran, then message "Can't locate object | #Error message:First part of program ran, then message "Can't locate object | ||
− | #method "hello" via package "world" (perhaps you forgot to load "world"? | + | #method "hello" via package "world" (perhaps you forgot to load "world"?</nowiki> |
− | + | <nowiki> | |
#Concatemate the DNA fragments into a third variable and print them | #Concatemate the DNA fragments into a third variable and print them | ||
#Using "string interpolation" | #Using "string interpolation" | ||
Line 67: | Line 67: | ||
#of trying to fix everything at once! | #of trying to fix everything at once! | ||
#Yes, the errors do seem to very accurately locate the source of the error and | #Yes, the errors do seem to very accurately locate the source of the error and | ||
− | #which line! I like the suggestion feature for what may have gone wrong... | + | #which line! I like the suggestion feature for what may have gone wrong...</pre> |
Latest revision as of 11:00, 23 September 2009
Return to Week 1
Exercise 4.1 in Beginning Perl for Bioinformatics.
#!/usr/bin/perl -w use strict; #Erika Phelps #Sept 20, 2009 #Homework Chp 4 #(using example 4-2) #concatemating DNA (that means, joining strings of DNA together) #Store two DNA fragments into two variables called $DNA1 and $DNA2 # #REMOVE SEMICOLON #Error message: 5 lines that say "global symbol requires explicit #package name. Syntex error on line 9 (correct) near "my" my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC'; my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA'; #*MISSPELL PRINT* #Error message: String found where operator expected line 22 (correct) near #"prnt" + message... (do you need to predeclare "prnt?) #Syntax error ... also NA fragments #Print the DNA onto the screen print "Here are the orginal two DNA fragments: \n\n"; print $DNA1, "\n"; print $DNA2, "\n\n"; #*ADD A CURLY BRACE RANDOMLY* #Error message:none, just added a curly brace in front of variable #*TYPE RANDOM TEXT* ("hello world" in comments w/out preceding "#") #Error message:First part of program ran, then message "Can't locate object #method "hello" via package "world" (perhaps you forgot to load "world"?</nowiki> <nowiki> #Concatemate the DNA fragments into a third variable and print them #Using "string interpolation" my $DNA3 = "$DNA1$DNA2"; print "Here is the concatenation of the first two fragments (version 1):\n\n"; print "$DNA3\n\n"; #An alternative way using the "dot operator": #Concatenate the DNA fragments into a third variable and print them my $DNA4 = $DNA1 . $DNA2; print "Here is the concatentation of the first two fragments (version 2):\n\n"; print "$DNA4\n\n"; #Print the same thing without using the variable $DNA3 or $DNA4 print "Here is the concatentation of the first two fragments (version 3):\n\n"; print $DNA1, $DNA2, "\n"; exit; #Sometimes a simple error generates many lines of code. When checking for errors #should try things out one at a time until no error message remains instead #of trying to fix everything at once! #Yes, the errors do seem to very accurately locate the source of the error and #which line! I like the suggestion feature for what may have gone wrong...