Difference between revisions of "Exercise 4.3"
Jump to navigation
Jump to search
| (3 intermediate revisions by the same user not shown) | |||
| Line 3: | Line 3: | ||
<b>Exercise 4.3 in <i>Beginning Perl for Bioinformatics</i></b> | <b>Exercise 4.3 in <i>Beginning Perl for Bioinformatics</i></b> | ||
<br><br> | <br><br> | ||
| − | < | + | <pre> |
#!/usr/bin/perl -w | #!/usr/bin/perl -w | ||
| − | use strict; | + | use strict; |
| − | + | #Erika Phelps | |
#Sept 21, 2009 | #Sept 21, 2009 | ||
| − | #Exercise 4.3 | + | #Exercise 4.3 |
| − | + | #Write a program that prints DNA (which could be in upper or lower case) | |
#in lowercase; write another that prints the DNA in uppercase. Use the | #in lowercase; write another that prints the DNA in uppercase. Use the | ||
| − | #function tr///. | + | #function tr///. |
#The DNA (input both in upper and lower case) | #The DNA (input both in upper and lower case) | ||
| Line 52: | Line 52: | ||
exit; | exit; | ||
| + | </pre> | ||
Latest revision as of 13:00, 23 September 2009
Return to Week 1
Exercise 4.3 in Beginning Perl for Bioinformatics
#!/usr/bin/perl -w use strict; #Erika Phelps #Sept 21, 2009 #Exercise 4.3 #Write a program that prints DNA (which could be in upper or lower case) #in lowercase; write another that prints the DNA in uppercase. Use the #function tr///. #The DNA (input both in upper and lower case) my $DNA1 = 'ATGCCGGTAGAATATACCCGA'; my $DNA2 = 'cccggctaatatacgctag'; #Print the DNA to the screen print "Here are the DNA sequences that have been provided:\n\n"; print "DNA1:$DNA1.\n\n"; print "DNA2: $DNA2.\n\n"; #Concatenating the DNA my $DNA3 = "$DNA1$DNA2"; #Make a copy of the DNA for both upper and lower case my $DNAlc = $DNA3; my $DNAuc = $DNA3; #Print the concatenated DNA all in lowercase $DNAlc =~ tr/ACGTacgt/acgt/; print "The concatenated DNA is (lowercase):$DNAlc.\n\n"; #Print the concatenated DNA all in uppercase $DNAuc =~ tr/ACGTacgt/ACGT/; print "The concatenated DNA is (uppercase):$DNAuc.\n"; #End of program exit;
