Damian: New page: Return to Aug 30-Sept 5

 #!/usr/bin/perl -w  use strict;   #Damian Almiron  #Ex 4-4   # Repeat Ex 4-3, but use the string directives \U and \L    #The DNA variables (upper and lo...

2009-12-18T16:24:46Z

New page: Return to Aug 30-Sept 5 <pre> #!/usr/bin/perl -w use strict; #Damian Almiron #Ex 4-4 # Repeat Ex 4-3, but use the string directives \U and \L #The DNA variables (upper and lo...

New page

Return to [[Aug 30-Sept 5]]

<pre>
#!/usr/bin/perl -w

use strict;

#Damian Almiron

#Ex 4-4

# Repeat Ex 4-3, but use the string directives \U and \L

#The DNA variables (upper and lower case)

my $DNA1 = 'ACTGACTGACTGACTACTGACTGACTGACTG';

my $DNA2 = 'actgactgactgactgactgactgactgactgactg';

#Print the DNAs

print "Here are our original DNA sequences in upper and lower case:\n\n";

print "DNAuppercase:$DNA1.\n\n";

print "DNAlowercase:$DNA2.\n\n";

#Make copies

my $DNAU1 = $DNA1;

my $DNAU2 = $DNA2;

my $DNAL1 = $DNA1;

my $DNAL2 = $DNA2;

#Print the DNAs in lowercase

print "The DNAs in uppercase:.\n\n";

print �DNA1:\U$DNAU1.\n\n�;

print �DNA2:\U$DNAU2.\n\n�;

#Print the DNAs in uppercase

print "The DNAs in lowercase:.\n\n";

print �DNA1:\L$DNAL1.\n\n�;

print �DNA2:\L$DNAL2.\n\n�;

#THE END

exit;

</pre>

Exercise 4.4 D - Revision history

Damian: New page: Return to Aug 30-Sept 5
#!/usr/bin/perl -w use strict; #Damian Almiron #Ex 4-4 # Repeat Ex 4-3, but use the string directives \U and \L #The DNA variables (upper and lo...