<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>https://wiki.cs.earlham.edu/index.php?action=history&amp;feed=atom&amp;title=Exercise_4.4_D</id>
	<title>Exercise 4.4 D - Revision history</title>
	<link rel="self" type="application/atom+xml" href="https://wiki.cs.earlham.edu/index.php?action=history&amp;feed=atom&amp;title=Exercise_4.4_D"/>
	<link rel="alternate" type="text/html" href="https://wiki.cs.earlham.edu/index.php?title=Exercise_4.4_D&amp;action=history"/>
	<updated>2026-09-10T07:19:31Z</updated>
	<subtitle>Revision history for this page on the wiki</subtitle>
	<generator>MediaWiki 1.44.2</generator>
	<entry>
		<id>https://wiki.cs.earlham.edu/index.php?title=Exercise_4.4_D&amp;diff=10592&amp;oldid=prev</id>
		<title>Damian: New page: Return to Aug 30-Sept 5  &lt;pre&gt; #!/usr/bin/perl -w  use strict;   #Damian Almiron  #Ex 4-4   # Repeat Ex 4-3, but use the string directives \U and \L    #The DNA variables (upper and lo...</title>
		<link rel="alternate" type="text/html" href="https://wiki.cs.earlham.edu/index.php?title=Exercise_4.4_D&amp;diff=10592&amp;oldid=prev"/>
		<updated>2009-12-18T16:24:46Z</updated>

		<summary type="html">&lt;p&gt;New page: Return to &lt;a href=&quot;/index.php/Aug_30-Sept_5&quot; title=&quot;Aug 30-Sept 5&quot;&gt;Aug 30-Sept 5&lt;/a&gt;  &amp;lt;pre&amp;gt; #!/usr/bin/perl -w  use strict;   #Damian Almiron  #Ex 4-4   # Repeat Ex 4-3, but use the string directives \U and \L    #The DNA variables (upper and lo...&lt;/p&gt;
&lt;p&gt;&lt;b&gt;New page&lt;/b&gt;&lt;/p&gt;&lt;div&gt;Return to [[Aug 30-Sept 5]]&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
#!/usr/bin/perl -w&lt;br /&gt;
&lt;br /&gt;
use strict; &lt;br /&gt;
&lt;br /&gt;
#Damian Almiron&lt;br /&gt;
&lt;br /&gt;
#Ex 4-4 &lt;br /&gt;
&lt;br /&gt;
# Repeat Ex 4-3, but use the string directives \U and \L  &lt;br /&gt;
&lt;br /&gt;
#The DNA variables (upper and lower case) &lt;br /&gt;
&lt;br /&gt;
my $DNA1 = &amp;#039;ACTGACTGACTGACTACTGACTGACTGACTG&amp;#039;;&lt;br /&gt;
&lt;br /&gt;
my $DNA2 = &amp;#039;actgactgactgactgactgactgactgactgactg&amp;#039;; &lt;br /&gt;
&lt;br /&gt;
#Print the DNAs &lt;br /&gt;
&lt;br /&gt;
print &amp;quot;Here are our original DNA sequences in upper and lower case:\n\n&amp;quot;;&lt;br /&gt;
&lt;br /&gt;
print &amp;quot;DNAuppercase:$DNA1.\n\n&amp;quot;;&lt;br /&gt;
&lt;br /&gt;
print &amp;quot;DNAlowercase:$DNA2.\n\n&amp;quot;; &lt;br /&gt;
&lt;br /&gt;
#Make copies&lt;br /&gt;
&lt;br /&gt;
my $DNAU1 = $DNA1;&lt;br /&gt;
&lt;br /&gt;
my $DNAU2 = $DNA2;&lt;br /&gt;
&lt;br /&gt;
my $DNAL1 = $DNA1;&lt;br /&gt;
&lt;br /&gt;
my $DNAL2 = $DNA2; &lt;br /&gt;
&lt;br /&gt;
#Print the DNAs in lowercase  &lt;br /&gt;
&lt;br /&gt;
print &amp;quot;The DNAs in uppercase:.\n\n&amp;quot;;&lt;br /&gt;
&lt;br /&gt;
print �DNA1:\U$DNAU1.\n\n�;&lt;br /&gt;
&lt;br /&gt;
print �DNA2:\U$DNAU2.\n\n�; &lt;br /&gt;
&lt;br /&gt;
#Print the DNAs in uppercase &lt;br /&gt;
&lt;br /&gt;
print &amp;quot;The DNAs in lowercase:.\n\n&amp;quot;;&lt;br /&gt;
&lt;br /&gt;
print �DNA1:\L$DNAL1.\n\n�;&lt;br /&gt;
&lt;br /&gt;
print �DNA2:\L$DNAL2.\n\n�;&lt;br /&gt;
&lt;br /&gt;
#THE END&lt;br /&gt;
&lt;br /&gt;
exit;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;/div&gt;</summary>
		<author><name>Damian</name></author>
	</entry>
</feed>