Damian: New page: Return to Aug 30-Sept 5

  #!/usr/bin/perl -w  use strict;   #Damian Almiron  #Ex 4-3   #Pseudocode  #Write a program that prints DNA (that could be in either upper- or lower #cas...

2009-12-18T16:22:14Z

New page: Return to Aug 30-Sept 5 <pre> #!/usr/bin/perl -w use strict; #Damian Almiron #Ex 4-3 #Pseudocode #Write a program that prints DNA (that could be in either upper- or lower #cas...

New page

Return to [[Aug 30-Sept 5]]

<pre>

#!/usr/bin/perl -w

use strict;

#Damian Almiron

#Ex 4-3

#Pseudocode

#Write a program that prints DNA (that could be in either upper- or lower #case
#originally) in lowercase (actg).

#Also, write a program that prints the DNA (that could be in either #upper- or
#ower #case originally) in uppercase (ACTG). Use the

#function tr///.

#The DNA variables (upper and lower case)

my $DNA1 = 'ACTGACTGACTGACTACTGACTGACTGACTG';

my $DNA2 = 'actgactgactgactgactgactgactgactgactg';

#Print the DNAs

print "Here are our original DNA sequences in upper and lower case:\n\n";

print "DNAuppercase:$DNA1.\n\n";

print "DNAlowercase:$DNA2.\n\n";

#Make copies

my $DNAU1 = $DNA1;

my $DNAU2 = $DNA2;

my $DNAL1 = $DNA1;

my $DNAL2 = $DNA2;

#Turn both DNA strands in uppercase only and print.

$DNAU1 =~ tr/ACGTacgt/ACGT/;

$DNAU2 =~ tr/ACGTacgt/ACGT/;

print "The DNA strands are in uppercase.\n\n�;

print �DNA1:$DNAU1.\n\n";

print �DNA2:$DNAU2.\n\n�;

#Turn both DNA strands in lower case only and print.

$DNAL1 =~ tr/ACGTacgt/acgt/;

$DNAL2 =~ tr/ACGTacgt/acgt/;

print "The DNA strands are in lowercase.\n\n";

print �DNA1:$DNAL1.\n\n";

print �DNA2:$DNAL2.\n\n�;

#The End

exit;

</pre>

Exercise 4.3 D - Revision history

Damian: New page: Return to Aug 30-Sept 5
#!/usr/bin/perl -w use strict; #Damian Almiron #Ex 4-3 #Pseudocode #Write a program that prints DNA (that could be in either upper- or lower #cas...