Exercise 4.1 - Revision history

Erika at 16:00, 23 September 2009

2009-09-23T16:00:02Z

← Older revision		Revision as of 16:00, 23 September 2009
Line 3:		Line 3:
	'''Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.'''		'''Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.'''

	<~~nowiki~~>#!/usr/bin/perl -w		<pre>#!/usr/bin/perl -w
	use strict;~~</nowiki>~~		use strict;

	~~<nowiki>~~#Erika Phelps		#Erika Phelps
	#Sept 20, 2009		#Sept 20, 2009
	#Homework Chp 4~~</nowiki>~~		#Homework Chp 4

	~~<nowiki>~~#(using example 4-2)		#(using example 4-2)
	#concatemating DNA (that means, joining strings of DNA together)~~</nowiki>~~		#concatemating DNA (that means, joining strings of DNA together)

	~~<nowiki>~~#Store two DNA fragments into two variables called $DNA1 and $DNA2		#Store two DNA fragments into two variables called $DNA1 and $DNA2
	#		#
	#REMOVE SEMICOLON		#REMOVE SEMICOLON
Line 19:		Line 19:
	#package name. Syntex error on line 9 (correct) near "my"		#package name. Syntex error on line 9 (correct) near "my"
	my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC';		my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC';
	my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';~~</nowiki>~~		my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';

	~~<nowiki>~~#MISSPELL PRINT		#MISSPELL PRINT
	#Error message: String found where operator expected line 22 (correct) near		#Error message: String found where operator expected line 22 (correct) near
	#"prnt" + message... (do you need to predeclare "prnt?)		#"prnt" + message... (do you need to predeclare "prnt?)
	#Syntax error ... also NA fragments		#Syntax error ... also NA fragments
	#Print the DNA onto the screen		#Print the DNA onto the screen
	print "Here are the orginal two DNA fragments: \n\n";~~</nowiki>~~		print "Here are the orginal two DNA fragments: \n\n";

	print $DNA1, "\n";		print $DNA1, "\n";
Line 32:		Line 32:
	print $DNA2, "\n\n";		print $DNA2, "\n\n";

	~~<nowiki>~~#ADD A CURLY BRACE RANDOMLY		#ADD A CURLY BRACE RANDOMLY
	#Error message:none, just added a curly brace in front of variable		#Error message:none, just added a curly brace in front of variable
	#TYPE RANDOM TEXT ("hello world" in comments w/out preceding "#")		#TYPE RANDOM TEXT ("hello world" in comments w/out preceding "#")
Line 40:		Line 40:
	#Concatemate the DNA fragments into a third variable and print them		#Concatemate the DNA fragments into a third variable and print them
	#Using "string interpolation"		#Using "string interpolation"
	my $DNA3 = "$DNA1$DNA2";~~</nowiki>~~		my $DNA3 = "$DNA1$DNA2";

	print "Here is the concatenation of the first two fragments (version 1):\n\n";		print "Here is the concatenation of the first two fragments (version 1):\n\n";

	print "$DNA3\n\n";		print "$DNA3\n\n";
	~~<nowiki>~~
	#An alternative way using the "dot operator":		#An alternative way using the "dot operator":
	#Concatenate the DNA fragments into a third variable and print them		#Concatenate the DNA fragments into a third variable and print them
	my $DNA4 = $DNA1 . $DNA2;~~</nowiki>~~		my $DNA4 = $DNA1 . $DNA2;

	print "Here is the concatentation of the first two fragments (version 2):\n\n";		print "Here is the concatentation of the first two fragments (version 2):\n\n";
Line 63:		Line 63:


	~~<nowiki>~~#Sometimes a simple error generates many lines of code. When checking for errors		#Sometimes a simple error generates many lines of code. When checking for errors
	#should try things out one at a time until no error message remains instead		#should try things out one at a time until no error message remains instead
	#of trying to fix everything at once!		#of trying to fix everything at once!
	#Yes, the errors do seem to very accurately locate the source of the error and		#Yes, the errors do seem to very accurately locate the source of the error and
	#which line! I like the suggestion feature for what may have gone wrong...</~~nowiki~~>		#which line! I like the suggestion feature for what may have gone wrong...</pre>

Erika at 03:37, 21 September 2009

2009-09-21T03:37:31Z

← Older revision		Revision as of 03:37, 21 September 2009
Line 1:		Line 1:
	Return to [[Week 1]]		Return to [[Week 1]]

	Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.		'''Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.'''

	<nowiki>#!/usr/bin/perl -w		<nowiki>#!/usr/bin/perl -w

Erika at 03:37, 21 September 2009

2009-09-21T03:37:17Z

← Older revision		Revision as of 03:37, 21 September 2009
Line 4:		Line 4:

	<nowiki>#!/usr/bin/perl -w		<nowiki>#!/usr/bin/perl -w
	use strict;		use strict;</nowiki>

	#Erika Phelps		<nowiki>#Erika Phelps
	#Sept 20, 2009		#Sept 20, 2009
	#Homework Chp 4		#Homework Chp 4</nowiki>

	#(using example 4-2)		<nowiki>#(using example 4-2)
	#concatemating DNA (that means, joining strings of DNA together)		#concatemating DNA (that means, joining strings of DNA together)</nowiki>

	#Store two DNA fragments into two variables called $DNA1 and $DNA2		<nowiki>#Store two DNA fragments into two variables called $DNA1 and $DNA2
	#		#
	#REMOVE SEMICOLON		#REMOVE SEMICOLON
Line 19:		Line 19:
	#package name. Syntex error on line 9 (correct) near "my"		#package name. Syntex error on line 9 (correct) near "my"
	my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC';		my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC';
	my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';		my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';</nowiki>

	#MISSPELL PRINT		<nowiki>#MISSPELL PRINT
	#Error message: String found where operator expected line 22 (correct) near		#Error message: String found where operator expected line 22 (correct) near
	#"prnt" + message... (do you need to predeclare "prnt?)		#"prnt" + message... (do you need to predeclare "prnt?)
	#Syntax error ... also NA fragments		#Syntax error ... also NA fragments
	#Print the DNA onto the screen		#Print the DNA onto the screen
	print "Here are the orginal two DNA fragments: \n\n";		print "Here are the orginal two DNA fragments: \n\n";</nowiki>

	print $DNA1, "\n";		print $DNA1, "\n";
Line 32:		Line 32:
	print $DNA2, "\n\n";		print $DNA2, "\n\n";

	#ADD A CURLY BRACE RANDOMLY		<nowiki>#ADD A CURLY BRACE RANDOMLY
	#Error message:none, just added a curly brace in front of variable		#Error message:none, just added a curly brace in front of variable
	#TYPE RANDOM TEXT ("hello world" in comments w/out preceding "#")		#TYPE RANDOM TEXT ("hello world" in comments w/out preceding "#")
	#Error message:First part of program ran, then message "Can't locate object		#Error message:First part of program ran, then message "Can't locate object
	#method "hello" via package "world" (perhaps you forgot to load "world"?		#method "hello" via package "world" (perhaps you forgot to load "world"?</nowiki>
			<nowiki>
	#Concatemate the DNA fragments into a third variable and print them		#Concatemate the DNA fragments into a third variable and print them
	#Using "string interpolation"		#Using "string interpolation"
	my $DNA3 = "$DNA1$DNA2";		my $DNA3 = "$DNA1$DNA2";</nowiki>

	print "Here is the concatenation of the first two fragments (version 1):\n\n";		print "Here is the concatenation of the first two fragments (version 1):\n\n";

	print "$DNA3\n\n";		print "$DNA3\n\n";
			<nowiki>
	#An alternative way using the "dot operator":		#An alternative way using the "dot operator":
	#Concatenate the DNA fragments into a third variable and print them		#Concatenate the DNA fragments into a third variable and print them
	my $DNA4 = $DNA1 . $DNA2;		my $DNA4 = $DNA1 . $DNA2;</nowiki>

	print "Here is the concatentation of the first two fragments (version 2):\n\n";		print "Here is the concatentation of the first two fragments (version 2):\n\n";
Line 63:		Line 63:


	#Sometimes a simple error generates many lines of code. When checking for errors		<nowiki>#Sometimes a simple error generates many lines of code. When checking for errors
	#should try things out one at a time until no error message remains instead		#should try things out one at a time until no error message remains instead
	#of trying to fix everything at once!		#of trying to fix everything at once!
	#Yes, the errors do seem to very accurately locate the source of the error and		#Yes, the errors do seem to very accurately locate the source of the error and
	#which line! I like the suggestion feature for what may have gone wrong...</nowiki>		#which line! I like the suggestion feature for what may have gone wrong...</nowiki>

Erika at 03:34, 21 September 2009

2009-09-21T03:34:36Z

← Older revision		Revision as of 03:34, 21 September 2009
Line 3:		Line 3:
	Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.		Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.

	"#!/usr/bin/perl -w		<nowiki>#!/usr/bin/perl -w
	use strict;		use strict;

Line 67:		Line 67:
	#of trying to fix everything at once!		#of trying to fix everything at once!
	#Yes, the errors do seem to very accurately locate the source of the error and		#Yes, the errors do seem to very accurately locate the source of the error and
	#which line! I like the suggestion feature for what may have gone wrong..."		#which line! I like the suggestion feature for what may have gone wrong...</nowiki>

Erika at 03:33, 21 September 2009

2009-09-21T03:33:58Z

← Older revision		Revision as of 03:33, 21 September 2009
Line 3:		Line 3:
	Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.		Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.

	#!/usr/bin/perl -w		"#!/usr/bin/perl -w
	use strict;		use strict;

Line 67:		Line 67:
	#of trying to fix everything at once!		#of trying to fix everything at once!
	#Yes, the errors do seem to very accurately locate the source of the error and		#Yes, the errors do seem to very accurately locate the source of the error and
	#which line! I like the suggestion feature for what may have gone wrong...		#which line! I like the suggestion feature for what may have gone wrong..."

Erika: New page: Return to Week 1 Exercise 4.1 in Beginning Perl for Bioinformatics. #!/usr/bin/perl -w use strict; #Erika Phelps #Sept 20, 2009 #Homework Chp 4 #(using example 4-2) #concate...

2009-09-21T03:33:24Z

New page: Return to Week 1 Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>. #!/usr/bin/perl -w use strict; #Erika Phelps #Sept 20, 2009 #Homework Chp 4 #(using example 4-2) #concate...

New page

Return to [[Week 1]]

Exercise 4.1 in <i>Beginning Perl for Bioinformatics</i>.

#!/usr/bin/perl -w
use strict;

#Erika Phelps
#Sept 20, 2009
#Homework Chp 4

#(using example 4-2)
#concatemating DNA (that means, joining strings of DNA together)

#Store two DNA fragments into two variables called $DNA1 and $DNA2
#
#REMOVE SEMICOLON
#Error message: 5 lines that say "global symbol requires explicit
#package name. Syntex error on line 9 (correct) near "my"
my $DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGATTAGC';
my $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';

#*MISSPELL PRINT*
#Error message: String found where operator expected line 22 (correct) near
#"prnt" + message... (do you need to predeclare "prnt?)
#Syntax error ... also NA fragments
#Print the DNA onto the screen
print "Here are the orginal two DNA fragments: \n\n";

print $DNA1, "\n";

print $DNA2, "\n\n";

#*ADD A CURLY BRACE RANDOMLY*
#Error message:none, just added a curly brace in front of variable
#*TYPE RANDOM TEXT* ("hello world" in comments w/out preceding "#")
#Error message:First part of program ran, then message "Can't locate object
#method "hello" via package "world" (perhaps you forgot to load "world"?

#Concatemate the DNA fragments into a third variable and print them
#Using "string interpolation"
my $DNA3 = "$DNA1$DNA2";

print "Here is the concatenation of the first two fragments (version 1):\n\n";

print "$DNA3\n\n";

#An alternative way using the "dot operator":
#Concatenate the DNA fragments into a third variable and print them
my $DNA4 = $DNA1 . $DNA2;

print "Here is the concatentation of the first two fragments (version 2):\n\n";

print "$DNA4\n\n";

#Print the same thing without using the variable $DNA3 or $DNA4

print "Here is the concatentation of the first two fragments (version 3):\n\n";

print $DNA1, $DNA2, "\n";

exit;

#Sometimes a simple error generates many lines of code. When checking for errors
#should try things out one at a time until no error message remains instead
#of trying to fix everything at once!
#Yes, the errors do seem to very accurately locate the source of the error and
#which line! I like the suggestion feature for what may have gone wrong...